The phrase "a type of sequence" is correct and usable in written English.
You can use it when describing a specific category or classification of sequences in mathematics, programming, or other contexts.
Example: "In mathematics, a type of sequence known as an arithmetic sequence has a constant difference between consecutive terms."
Alternatives: "a category of sequence" or "a form of sequence".
In the next result we show that choosing a type of sequence ({alpha_{n}}_{ngeq0}) in the Mann iteration has a notable role to play in the rate of convergence of the sequence ({x_{n}}_{ngeq0}).
Among these, the most accepted hypothesis is that the R-richness on the LeS and R-poorness on the LaS might be a type of sequence signature of the heterodimeric DNA polymerase III alpha subunit in Firmicutes [ 24].
Remote homologous is a type of sequence that presents very low level of similarity or identity in regions (mainly 20% of conservation in multiple sequence alignment, also called the "midnight zone") and traditional methods of detection such as BLAST or FASTA are not able to detect this very low level of conservation within sequences (ie, in genes or genomes).
It is worth noting that both regions A ('ggtctagaatggaatggaaagaatgga') and B ('atacaatcgattggaatcgaatggaatggaagg') are near the centromere and both contain the repeated sequence 'tggaa', which is a type of common sequence repeats found near human centromeres [ 20].
A similar scheme was used to construct Inv2 which employed the same 19-nt sequence, but in the inverse orientation (Figure 1A), a type of scrambled sequence that was routinely used as a control for RNAi experiments.
To spot the mutations in the cells within the tampons, the researchers used a type of DNA sequencing called deep sequencing, which is able to detect tiny fractions of mutated DNA in a sample.
It is shown that if the analysis is performed by using a discrete model with N degrees of freedom, the leading principal minors of the Nth order dynamic stiffness matrix exhibit a type of Sturm sequence property.
To the scientists' surprise, a sizable fraction of the RNA transcripts in the first sample they tested a mouse pancreatic tumor were encoded by a type of DNA sequence called satellite repeats.
We propose that this is a type of convergent sequence evolution of numit rps13 that possibly improves the function of numit RPS13 in the ribosome.
One of them is the Tc1/mariner transposable element (TE) superfamily (a type of DNA sequence that can change its position within the genome. It belongs to one of the most diverse and widespread class II TEs).
Unexpectedly, the amplified cDNAs essentially consisted of a single type of sequence variant that contained a sequence (402 bp = 134 amino acids) corresponding to the middle region of LdcA.
