The phrase "a template result" is correct and usable in written English.
It can be used when referring to an outcome or output that follows a predefined format or structure, often in contexts like programming, design, or documentation.
Example: "The report generated a template result that can be easily modified for future projects."
Alternatives: "a standard output" or "a predefined outcome."
GNP acted as a template resulting in formation of large TiB2 grains with plate type morphology.
The applied pressure draws out the flowing polymer to generate droplets, which are later used for coating a template resulting in the fabrication of a structure.
Among these processes, the replication technique, also named the 'polymer-sponge' method (Fig. 4), has gained considerable attention, as it offers the potential of forming uniform dispersion of ceramic powder within a template, resulting in controllable pore size, high porosity and interconnectivity in scaffolds.
The transformation amplicon was generated by PCR using (TTGATCCTGCTTTTAACAATTTCGAATCGTTTGCGTAATTGAATTCGAGCTCGTTTA AAC) and (CCTCCTCTGGAGGCTTAATCTTAAAAAATTTCTTTAATCCGCACTGACGAGCGTAATCTG) using pFA6a-HIS3MX6-PGAL1-HA3 as a template, resulting in a transformation cassette directed in-frame to the N-terminus of Sec9p.
The CaMV 35S promoter of pSAT4-MCS was replaced by a chloroplast Prrn promoter, cloned as a AgeI/NcoI PCR fragment amplified using forward 5'-TCACCGGTCGCCGTCGTTCAATGAGAATGG-3' and reverse 5'-GAGCGAACTCCGGGCGAATATCCATGGTT-3' primers and Nicotiana tabacum plastid genomic DNA as a template, resulting in pCAS3 vector.
DSB repair by HR using a direct repeat within the reporter cassette as a template results in an intact GFP gene(Pierce et al., 1999).
The blast search against the protein databases with psTic62 [Swiss-Prot: Q8SKU2] as a template resulted in several sequences from which just two correspond to the full-length form of the mature psTic62: one from Arabidopsis thaliana [GenBank: NP_188519] and another from Oryza sativa [GenBank: ABG65881].
Higher concentration polymerase might have more opportunity to bind PTJ, which squint toward increase in the average length of products synthesized on a long template, result in more nonspecific products [25].
Utilization of a nanosized template resulted in a product with a relative uniform morphology and a small particle diameter in the region of 50 100 nm.
It promotes DNA broken ends bridging without using a specific template resulting therefore in a less accurate repair of DSB.
