Sentence examples similar to a string that includes the from inspiring English sources

Similar(60)

Since there is no specific standardised MeSH term, we developed a search string that includes the concepts of patient record, computers and data integration or sharing.

As the automatic translation produces a string that includes additional terms, we included them explicitly in our string.

It was the eighth consecutive victory for UConn (20-1, 10-0 Big East), a string that includes seven consecutive conference victories by an average of 39 points.

When we performed a blastn search of GenBank using a text string that included the minor sequence variant at both positions (ATTCTTCAAATATCTACTCATT), three of the 20 fully matching human results represented a NUMT on Chromosome 13.

In order to identify any cases not reported in the diagnosis fields, we searched the files describing hospitalisations, diagnoses, diaries, specialist examinations and reasons for examinations using a sensitive text string that included the words "acute otitis", "AOM", "myringitis", "ear pain", "fever", "ear discharge", "rhinitis", and "vomiting".

21 victory over Venezuela, a string that included three shutouts before last week's 5-1 win against Scotland.

A fingerprint is a bit-wise string, that includes only zeros and ones, encoding absences and presences of structural fragments.

(Nate Chinen) Fabian Almazan Trio with Strings (Wednesday) For this one-nighter, as on his 2011 debut, "Personalities" (Biophilia), the resourceful young Cuban pianist Fabian Almazan augments a quick-reflex trio with a string quartet that includes the violinist Meg Okura and the violist Karen Waltuch.

Considering that the search would focus on online databases with search engines that use Boolean descriptors, a decision was taken to organise a search string that included all the afore-mentioned possibilities, thus: "(education OR learning OR instruction) AND (adaptive OR individualized OR personalized) AND technology".

In 1953, Fermi, Pasta, Ulam and Mary Tsingou conducted computer simulations of a vibrating string that included a non-linear term (quadratic in one test, cubic in another, and a piecewise linear approximation to a cubic in a third).

However, this risk was minimised by using a search string that included all relevant terms pertaining to EBP (e.g. evidence-based practice; evidence based medicine; EBM; best evidence medical education; BEME; research evidence).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: