Sentence examples for a standard reference for from inspiring English sources

This work was a standard reference for several decades.

It is guaranteed to become a standard reference for years to come.

Laffont and Tirole's book will still become a standard reference for 1980s procurement and regulation models.

Futuyma provides an excellent overall view, while Hartl and Clark serves as a standard reference for population genetics.

In 1953, Dr. Feshbach and Dr. Philip M. Morse wrote the two-volume textbook "Methods of Theoretical Physics," a standard reference for decades of physics graduate students.

Provide convenient access to the digital libraries of formalized mathematics mentioned just above that is so useful that the formal material becomes a standard reference for mathematical knowledge and is widely cited in textbooks.

β-actin (Forward5'ATCATGTTTGAGACCTTCAA3', Reverse 5 CATCTCTTGCTCGAAGTCCA3') was chosen as a standard reference gene for the assay for normalization.

His textbook Child Psychiatry (1935) remained a standard reference work for 50 years.

Olson, W.K. et al. A standard reference frame for the description of nucleic acid base-pair geometry.

His advisers include Dr. Walter Unger, a hair-implant pioneer and author of "Hair Transplantation," a standard reference text for transplant surgeons.

A standard reference model for controlling robots, which consists of a hardware platform, an operating system module, and various application software modules, is first proposed.