Sentence examples for a specific left from inspiring English sources

But for runners, they are the latest step up in sock technology, because each pair consists of a specific left and right sock.

That meant I would be donning a shift and a doublet on top, breeches on the bottom, a lace bonnet on my head to make it classy, and two enormous shoes not assigned to a specific left or right foot.

Manager Joe Torre said he would treat Villone like "a left-handed right-hander," meaning he would pitch him an inning at a time, rather than have him face a specific left-handed hitter.

The rol-3 locus was originally defined by two mutations, e202 and e754 (Brenner, 1974), both of which give rise to an adult specific left-hand roller (LRol) phenotype.

In accordance with evidence from evolutionary psychology as well as from developmental psychology, we argue that cooperation is a socially rewarding process and is associated with specific left medial orbitofrontal cortex involvement.

Biondo and colleagues have recently evaluated the performance of the MPI as a predictor of immediate postoperative mortality, demonstrating an AuROC of 0.72 (95% CI 0.65 0.79), while, for the more specific left colonic Peritonitis Severity Score (PSS), the AuROC was 0.79 (95% CI 0.72 0.85) for this outcome [27].

The T-DNA specific (left border, HAS-2-4; right border, HS-1-3) arbitraryrary degenerate primers (AD1-3) are described in Table 1.

The gene specific left primer used for the 3' end had the sequence ACAAGGATGGGAATAGTGATGGT and was based on a F3'5'H sequence for Solanum tuberosum (accession number: AY675558).

"On Friday night, disaffected young people who didn't belong to some specific left-wing group — a Communist group or a Democratic Party group — and who wanted to talk things out, would sit and meet and discuss ethical issues and dance and go to parties," Mr. Millstone recalled.

In this study we propose a unified, fully automated approach to build a 3D patient-specific left atrium (LA) model including pulmonary veins (PVs) in order to provide an accurate anatomical guide during RFA and without PVs in order to characterize LA volumetry and support patient selection for AF ablation.

For instance, it is possible that for a specific time horizon ( left[ {t^{A},t^{{A^{prime}}} } right] ) of the period following time interval τ, the arrival rate of cell j may lift up (down) by 1 unit, whereas a corresponding decrease (increase) may occur in cell k (shown in Fig. 3).