Your English writing platform
Discover LudwigExact(1)
1C3H, which corresponds to a murine isoform of adiponectin, as a sole template.
Similar(59)
Trace the sole template on a piece of cardboard by measuring the size of your baby's feet; leave 1 centimeter (0.4 in) for seam allowance; cut out sole fabric, vamp fabric and counter fabric for four pieces each and two pieces for shoelace.
This gerontocracy sits atop a society in stress, where money, in the absence of constitutional tools or intellectual freedom, has been the only buffer against wrenching and rapid change.Young Saudis, schooled to accept Wahhabist Islam as the sole template for existence, yet increasingly exposed to a worldlier world, are particularly torn between urges to conform and rebel.
Integrated viral DNA is described to be the sole template for efficient viral transcription.
"Gerry is a sole practitioner.
There is a sole superpower Brazil.
A sole leader!
as a sole carbon source (Figure 1).
It will be a sole proprietorship.
PCR fragments that were synthesized by primer pairs (SPCC24B10.22_TAF, 5'-ATGTTAAAGCTACTACTTCAGCAGAGATTACAGAAGAAGACAAAAAAAACATTGCATATTTAAAAGCACAAGCATTTTAC TGGandCCCGGGTTAATTAA-3'; and SPCC24B10.22_DNR) on template pJH (pBlueScript containing a GFP coding sequence in pJH1000) were transformed into strain YJL1004 to yield YJL1003 containing a sole copy of pog1+ -GFP.
If possible, operate as a sole proprietor.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com