The phrase "a significant pair of" is correct and usable in written English.
It can be used when referring to two items or elements that hold importance or relevance in a particular context.
Example: "In the study, we identified a significant pair of variables that influenced the outcome of the experiment."
Alternatives: "an important duo of" or "a notable couple of".
Therefore, not only have we discovered a statistically significant pair of SNPs using an experiment-wise α of 0.05, but we have replicated the significant relationship in an independent dataset.
The pseudoknot pair has dissimilarity of 6. p1 x) UCUCUAUCAGAAUGGAUGUCUUGCUGCUAUAAUAGAUAGAGAAGGUUAUAGCAG.]]]]]]]]]] p1 y) UUGUACAGAAUGGUAAGCCAAGUGUCAAUAGGAGGUACAAGCAACCUAUUGCAU ….]]]]]]]]]] A weight is assigned to a significant pair, which is a combination of the free energy, covariation and dissimilarity.
Jesse Jackson, who likes to say that his role is to be the social conscience of the mighty ("Whether Michael or the President," he says, in a significant pairing), urges a sensible division of labor.
The resulting P-value of 3E-5 clearly validated the homology even in the absence of a significant pair-wise sequence similarity (Figure 2D).
Five significant pairs of interacting QTLs with PVE ranging between 9 and 17 % were detected.
In contrast, epistatic QTL mapping detected ten significant pairs of interacting QTLs.
Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures.
Given significant substructure pairs, for an arbitrary compound-protein (graph-sequence) pair, we can compute a binary vector of 10,000 elements where if a significant substructure pair is included, the value of the corresponding element is 1; otherwise zero.
Among the marker pairs mapping to different chromosomes, we found a significant excess of pairs relating segments derived from the same ALG relative to randomization controls (247 pairs vs. 102 ± 11, p < 0.001 in randomizations of all genes; 202 vs. 46 ± 7 when genes in tandem duplicates are excluded).
Values of p<0.05 were considered significant and tabulated (Table 4, column [A] shows the number of significant pair wise comparisons).
