The phrase "a shi" is not correct or usable in written English.
It appears to be an incomplete or misspelled expression, lacking context for proper usage.
Example: "I can't believe you just said a shi about that topic."
Alternatives: "a piece" or "a bit".
Waldheim was obviously not a spy, a Shi Peipu in a three-piece suit, any more than he was, technically speaking, a murderer.
And besides, it was more than 35 years ago that Sex Pistols went on British television and called host Bill Grundy a "fucking rotter" – in comparison, MIA sticking her middle digit up and saying "I don't give a shit" seems a bit tame (especially as she didn't manage to get the full "shit" out, it more like a "shi", really … maybe she had constipation).
Confucius was a shi, one of a class of formerly landed noblemen who had once been similar in status to the medieval European knight but by Confucius's time had lost their social privileges and served as scholar-officials in the government.
UV spectrum was measured with a Shi madzu UV2401PC spectrometer.
It's also small enough to be ingested by a Shi Tzu.
Two studies reported costs of treating HF from a SHI perspective in Germany [19, 20].
The plasmid pET-A-SHI was constructed to produce "tagless" recombinant P. furiosus SHI.
The tagless Pf SHI gene was amplified with primer pair 0891-NdeF (GandGGTTCCATATGAGGTATGTTAAGTTACCCAAGGA) and 0894-KpnR (ATAGGGTACCTTAAAGTCTAACCACGTGGACTGAGC), the NdeI/KpnI digested PCR product was inserted into similarly treated pET-A to produce pET-A-SHI.
This was not due to the additional N-terminal residues (∼2 kDa) on one of the subunits (PF0891, due to the Gateway cloning strategy) since the properties of the wild-type form of rSHI, obtained by recloning PF0891-PF0894 to include only the wild-type amino acid sequence (pET-A-SHI, Fig. 7), and that of Gateway-tagged rSHI were virtually identical (data not shown).
These individual acupoints called A-shi [40] correspond to hardened structures on the lateral side of the shank which was palpated during the foot rotation test.
This is attributed to an induced decomposition of this acrylic peroxide, due to the addition of macroradicals, arising from polypropylene, to the unsaturation followed by an SHi onto the peroxidic bond.
