Your English writing platform
Discover LudwigThe phrase "a set of flanking" is not complete and lacks context, but it is grammatically correct.
It can be used in contexts related to military strategy, architecture, or any situation where something is being supported or protected from the sides.
Example: "The general ordered a set of flanking maneuvers to outsmart the enemy forces."
Alternatives: "a series of side movements" or "a group of lateral supports".
Exact(3)
Dan_HSP47_2 and Gast_HSP47_2 are orthologous to each other, since they share a set of flanking markers that proved to be reciprocal best hits in BLAST searches (not shown).
A single radiation-induced deletion was defined by a set of flanking markers detecting an uninterrupted deletion smaller than a whole chromosome arm.
Periodic signals were stronger in a set of flanking sequences of substitutions that occurred at the third-codon positions than in those that occurred at the first- or second-codon positions.
Similar(57)
The cDNA was tested for genomic DNA contamination by PCR using a set of primers flanking an intron.
We designed a PCR assay in which both alleles are amplified simultaneously using a set of primers flanking the polymorphism.
Based on the matching genomic sequences obtained, we designed a set of primers flanking the region of interest.
Then, we compared the AsA-related genes with a randomly chosen gene set, a set of genes flanking the AsA-related genes, and core eukaryotic gene set; the AsA-related genes were retained at a higher frequency.
Two recent publications presented independently a set of four flanking markers for the R gene Ph-3 that confers resistance to certain P. infestans isolates in S. lycopersicum[ 15, 16].
Recombinable modules are defined as a set of exons flanked by introns of the same phase, typically phase-0 [ 6].
For that the promoter region of the gene was amplified using a set of CpG island flanking primers (sense 5'ttttgtttttattggttggatattt, antisense 5'ccttcaaccaatcacctcaatacct) followed by direct sequencing.
Addressing these issues will require the collection of a more extensive set of flanking sequences.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com