Your English writing platform
Discover LudwigThe phrase "a sequence unique to" is correct and usable in written English.
It can be used to describe a specific order or arrangement that is distinct to a particular subject or context.
Example: "The study revealed a sequence unique to the behavior of migratory birds during their nesting period."
Alternatives: "a pattern exclusive to" or "a series particular to".
Exact(6)
Chase L. Beisel at North Carolina State reported that Crispr could be used to kill one strain of bacteria in a mixture of strains, by targeting a sequence unique to that strain.
Determining which version at any given spot in the father's genome was passed to the fetus was fairly straightforward, since any fragments of DNA in the mother's blood containing a sequence unique to the father had to have come from the fetus.
Now scientists think they have cracked the code: Insect nerve cells appear to fire in a sequence unique to each smell, says a report in the 14 November issue of Nature.
rVV prepared from viral plaques was subjected to PCR using an 'inside' primer specific for a sequence unique to the recombinant M45 full-length gene (GCGCCGCGGCCGCTCGGCG) or M45 Db 985HGIRNASFI993 minigene (GATGAAGGAGGCGTTCCTGATGCCGTGC) as appropriate.
If contigs to be detected as DECs possessed a sequence unique to A. thaliana, such a sequence could not exhibit homology with the protein sequences in the database.
In contrast, over-expression of the gene was found in six of 11 samples as determined by immunocytochemistry and/or Western blot analysis, using an antiserum raised against a synthetic peptide representing a sequence unique to the N-myc gene product.
Similar(54)
Typically the abundance of each shRNA vector has been determined by PCR amplification across a DNA sequence unique to that vector (a so-called DNA barcode) followed by hybridization of the PCR product to a custom microarray containing oligonucleotides complementary to the various barcodes present in the library.
One fear is that such information could be used to create germs that hurt only a particular ethnic group, by targeting a gene sequence unique to that group.
The group of poorly conserved miRNAs identified in this study includes a subset termed as bovine specific miRNAs, which represent miRNAs with a seed sequence unique to Bos taurus.
For example, administration of a peptide sequence unique to tissue remodeling/fibrotic (M2) macrophages identified by subtractive phage biopanning and fused to the KLA proapoptotic peptide [286] decreased mortality in CT-26 tumor-bearing mice by inducing a decreased number of tumor-associated macrophages [287].
For this purpose, specific primers were designed to amplify a genomic sequence unique to P. vivax.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com