The phrase "a sequence unique" is not correct in standard English usage.
It may be intended to describe a sequence that is distinct or one-of-a-kind, but it lacks proper grammatical structure.
Example: "In mathematics, we often encounter a unique sequence that defines the Fibonacci series."
Alternatives: "a unique sequence" or "a distinct sequence".
Determining which version at any given spot in the father's genome was passed to the fetus was fairly straightforward, since any fragments of DNA in the mother's blood containing a sequence unique to the father had to have come from the fetus.
Now scientists think they have cracked the code: Insect nerve cells appear to fire in a sequence unique to each smell, says a report in the 14 November issue of Nature.
rVV prepared from viral plaques was subjected to PCR using an 'inside' primer specific for a sequence unique to the recombinant M45 full-length gene (GCGCCGCGGCCGCTCGGCG) or M45 Db 985HGIRNASFI993 minigene (GATGAAGGAGGCGTTCCTGATGCCGTGC) as appropriate.
If contigs to be detected as DECs possessed a sequence unique to A. thaliana, such a sequence could not exhibit homology with the protein sequences in the database.
This was also the case for amy2, where the 12.4-kb region including amy2 ORF, and its promoter and terminator regions were absent, but a sequence unique as observed in the amy1 region was not present in amy2.
We depleted Msi1 in the medulloblastoma cell line Daoy using a vector-based siRNA which targeted a sequence unique for Msi1 located in the 3'UTR of the gene.
For the per-protein analysis, we used a sequence-unique subset of DisProt that consisted of 205 proteins with at least one long (>30 residues) disordered region, and again, validated the results on a set that was created using the more stringent criterion for sequence uniqueness.
One fear is that such information could be used to create germs that hurt only a particular ethnic group, by targeting a gene sequence unique to that group.
They also examined a DNA sequence unique in each case of leukemia, the BCR-ABL1 sequence.
For this purpose, specific primers were designed to amplify a genomic sequence unique to P. vivax.
Two electrochemical DNA hybridization biosensors (genosensors) for the detection of a 30-mer sequence unique to severe acute respiratory syndrome (SARS) virus are described in this work.
