Your English writing platform
Discover LudwigSimilar(59)
The original tunnel from LMA to MAG1 is extended to MAG2 using a new segment of label switched path (LSP).
Figure 1 shows a segment of the cholesterol biosynthesis pathway labelled with abbreviated small molecule names; Figure 2 shows full names.
He feels a segment of the media contingent has unfairly labeled him something he's not.
A 25-nt oligomer (CTCAGACAGAGACACCGTTGCTATG) complementary to a segment of ORF2 (capsid) was 3′-end labeled by the addition of a single digoxigenin-II-dideoxy undine (Eurofins MWG Operon, Huntsville, AL, USA).
The methodology firstly characterizes the wave height time series by approximating it using a sequence of labeled segments, and then a binary classifier is trained to predict the occurrence of SSWH periods based on past height values.
This fragment, containing 3×P3-ECFP and a segment of the piggyBac left terminus was labelled with [α-32P]dCTP using Ready-To-Go DNA labelling beads (Amersham Biosciences).
Soon after, on an April 2003 episode of SmackDown! during a segment labeled as Torrie's Playboy Coming Out Party former Diva and Playboy covergirl Sable made her return to WWE after a four-year absence.
Observations of retrogradely labeled somata located within labeled patches of axonal segments (e.g., fig. 2 of Angelucci et al. 2002b; fig. 7 of Tyler et al. 1998; Rockland et al. 1982; Rockland and Lund 1983) indicate that projections are patch reciprocal over a set of labeled patches (observation C).
If enough browsers display similar patterns, they become part of a "segment" labelled something like "football lovers", "fine food lovers", "current affairs enthusiasts", etc – these become labels that Doubleclick lets advertisers choose from when they select the types of people they want to see their ads.
Fig. 7 Average accuracy as a function of the number of labeled data segments.
To explore the influence of the numbers of labeled segments on the performance of the algorithm, different numbers of labeled data are used.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com