Sentence examples for a segment of genomic from inspiring English sources

Toward this end, the researchers scanned genomic sequences from close to 50 modern humans of Eurasian ancestry looking for regions that were unusually variable; because older sequences have had a longer time to accumulate small changes than younger sequences, the degree of variability of a segment of genomic sequence can be an indicator of how old that sequence is.

As defined here, "gene calling" indicates justification of a segment of genomic DNA containing an open reading frame coding for a protein based on the gene-searching tools employed.

Third, the PGC phenotype was fully rescued by a transgene bearing a segment of genomic DNA including the entire Neurl4 transcription unit and flanking intergenic regions, but neither of the adjacent genes (Fig. 1F).

A segment of genomic DNA containing both the Csf1r promoter and FIRE sequence is sufficient to drive expression of green fluorescent protein (eGFP) specifically in all macrophage lineage cells in transgenic mice (Sasmono et al., 2003; Ovchinnikov et al., 2010).

Given a segment of genomic nucleotide sequence, s(i: i + w-1) = s i, s i + 1,..., s i + w -1, the information (log-odds) score ISfeature(s(i: i + w-1)) of the segment having a feature (5'ss, 3'ss, or BP) is defined as: (3) I S feature (s (i : i + w − 1 ) ) = ∑ j = 1, w p w m (s i + j − 1, j ).

When h is a segment of genome g, the intra-genomic delta-distances are log-normally distributed, with means approaching zero slightly slower than reciprocal square root of segment length.

A segment of the genomic contig from the RY2G5 to the BASE gene was used as query in a BLAST search of a bovine repetitive sequence database [ 25] to search for the presence of repeat elements within it.

Preparation of conventional dsDNA linkers conjugated to DNA hairpins: Autosticky-PCR 18 was performed on a segment of M13mp18 genomic DNA to produce two products: 1) 5′ bp+abasic24 bp+abasite+hairpin+30nt30nt 5′ overhang, and 2) 30nt 5′ overhang (complementary to 5′ overhang in product (1))+563 bp+5′ digoxigenin.

Simple sequence length polymorphism (SSLP) markers, similar to SSR markers, are designed based on a unique segment of genomic DNA sequence that contains a simple tandem repeat that distinguishes the genotypes.

The forward primer GGGAGTCCGATGGTGAGTTA and reverse primer ACTTGCGCTCATTCATTGTG were used to amplify a 1057-bp segment of genomic DNA from the dom locus (genomic position 17215713 17216769).

A large segment of genomic sequence was amplified for each SCGB1A1 gene and the partial coding sequences leading to the mature secreted proteins were sequenced.