The phrase "a second round of amplification using" is correct and usable in written English.
It can be used in contexts where you are discussing a process that involves enhancing or increasing the strength of something, typically in scientific or technical fields.
Example: "The researchers conducted a second round of amplification using a more sensitive method to ensure accurate results."
Alternatives: "a subsequent phase of amplification with" or "an additional round of amplification employing".
DNA extracted from the samples was initially amplified using universal 16S rDNA primers, followed by a second round of amplification using the first PCR products to detect a specific fragment of the 16S rDNA of each target Treponema species.
Products obtained from Long-range PCR were then used as a template in a second round of amplification, using appropriate primers to isolate individual exons for sequencing.
A 1 1 mixture of these two fragments, which overlap in the region to be mutated, served as the template for a second round of amplification using the 5′ and 3′ terminal primers to extend the full-length Int* sequence.
A second round of amplification used the first polymerase chain reaction products to specifically detect D pneumosintes.
Labeling of cRNA was performed during a third round of amplification using biotinylated nucleotides (Enzo Diagnostics).
Then 2 μL of the first-round PCR products were used as templates for the second round of amplification using communal A and B primers and reagents from the Multiplex PCR kit (Qiagen).
The second round of amplification, using random second round primers, was started with 1.0 μg aRNA in case of macrodissected samples.
In nPCR, a second round of amplification was performed using primers, which produce a specific 326 base-pair product.
Following the first round of amplification, a second round of amplification is performed using random primers that hybridize anywhere along the length of the transcript, and initiate 5' to 3' sequence replication.
If no PCR product was detected, then a second round of amplification was performed using 2 μl of PCR product as template.
One μl of the PCR mixture was subjected to a second round of amplification under the same conditions using primers Mxi1-A1 and Mxi1-R2b (CATGCTGGGTTCTATGAAGAG).
