Sentence examples for a quantity of 2 from inspiring English sources

A quantity of 2 gram (g) of SSNEDDS powders was poured into 10 ml measuring graduated cylinder.

Measurement of poured density and bulk density A quantity of 2 gram (g) of SSNEDDS powders was poured into 10 ml measuring graduated cylinder.

A quantity of 2 mL of the preheated (50°C) substrate solution was added to a cuvette, and the reaction was initiated by addition of 0.1 mL properly diluted enzyme solution.

A quantity of 2 mcg of genomic DNA was bisulfite-converted using the Cells-to-CpG Bisulfite conversion kit (Life Technologies Ltd ,Paisley, U.K .. To amplify and sequence the CpGI4 island we used the primers previously described by Tong et al. (Forward: TGTTATTTAGGTTGGAGTGTAAGGG; reverse: CAACCAAAAAAATTAAAAACCAACTCA).

The experiment was performed using a quantity of 15 mg of fresh prepared sample.

A quantity of 60 mg was resolved in 1 ml of distilled water, resulting in a concentration of 0.05 M.

A quantity of 0.0023 g of SWCNT was added to each solution which was then warmed to 470 K.

A quantity of 0.04- to 0.1-g dried sample was immersed in excess solvent at room temperature.

A quantity of 0.60 mL freshly prepared ice-cold NaBH4 0.010 M) was added all at once under vigourous stirring.

Glucose, arabinose, rhamnose, xylose, galactose, and mannose were used as standards with a quantity of 1 mg each.

From each volatile oil preparation a quantity of 50 μl was submitted to testing and the tests were done in triplicate.