Sentence examples similar to a positive optimization from inspiring English sources

After this positive optimization round, we perform a round of negative hard data mining [10] for each detector.

It is noted that the plate length of PHE has a positive effect on the optimization design of PHE.

The NTERA-2 cell line was used as a positive control and for optimization experiments.

Looking at other yeast systems, the expression of high yields of foreign cellulases with comparable activity and stability to the native forms were reported in P. pastoris [ 114- 116], where a positive effect by codon optimization could be shown [ 114].

These challenges are compounded by the fact that advancements in multiple technologies (for example materials processing, topology optimization) generate a "positive feedback loop" effect in advancing AM.

The optimization developed a positive heat exchange/pressure correlation for the net power output with reasonable cycle efficiencies of around 10% employing moderate device sizes.

To compute the smallest bound of a reachable set for linear dynamic systems (1), we solve the optimization problem for a positive scalar (delta>0): begin{aligned} &minquadbar{delta} quadbiggl(bar{ delta}=frac{1}{delta}biggr) &text{s.t.

EMVC optimization also had a positive impact on gene set enrichment replication, as measured by Kendall's coefficient of concordance on the enrichment P-values across multiple bootstrap resampled datasets.

Further optimization is achieved by introducing a positive definite weight matrix that penalizes the quadratic control term.

The sequence is as follows: aatggccgcaggtacctggat GAPDH targeted siRNA, was also produced for use as a positive control for message knockdown, and also for transfection condition optimization.

RNA extracted from T84 and COLO 205 cell lines were used in test experiments for method optimization and in the final experiments as a positive control.