Sentence examples for a pair of fully from inspiring English sources

They are joined at the hip, have two heads, two hearts,two sets of lungs and kidneys, four arms and a pair of fully functioning legs.

When he learned he had made it into the X Factor's live shows, largely due to his extraordinary costumery ("I had the long, blond, fake hair teamed with a pair of fully crystallised Converse hi-tops"), he crawled on the floor, sobbing, and wiped his nose on a cushion.

For the UHI analysis, we used a pair of fully equipped weather stations and for the analysis of intra-urban temperature differences a string of T/RH data loggers located across Glasgow on a N-S transect.

Adidas started it with a pair of fully knitted soccer cleats in 2014, and now that Kanye West issued limited-edition Yeezys (as IG'd by both a Kardashian and a Jenner), it's safe to say it's a full-blown trend.

A pair of fully reciprocal IL populations were produced in Arabidopsis [ 10], with the two accessions used once as donor and once as recipient.

Site-directed mutagenesis of ARR22 was carried out on the ARR22 Entry clones using QuikChange® Site-Directed Mutagenesis Kit (Stratagene) and a pair of fully complementary primers for the designed region GGCGAAGCTAGCTTCGACCTTATTCTAATGGAGAAGG containing D74E mutation and NheI restriction site or CGACCTTATTCTCATGAATAAGGAAATGCCTGAG containing D74N mutation and PagI restriction site.

However, since hop count of a pair of nodes cannot fully reflect the distance, it is difficult to obtain a good estimate for a node.

Even the stems on a pair of martini glasses were fully loaded.

The event was advertised heavily and required viewers to buy or obtain a pair of anaglyph glasses to fully enjoy the movie; this was an anaglyph 3D version of the film created from the Arrivision original.

A sloped edge combined with a drilled hole near the haunch tip, or a pair of stiffeners that partially or fully extended from the beam web, successfully prevented crack initiation at the haunch tip.

Physiological parameters were determined by using the second pair of fully expanded leaves.