The phrase "a pair of constructs" is correct and usable in written English.
It can be used when referring to two related or complementary ideas, models, or frameworks in a specific context, such as academic writing or technical discussions.
Example: "In our analysis, we will examine a pair of constructs that influence consumer behavior: motivation and perception."
Alternatives: "two constructs" or "a duo of constructs".
To generate Tlr4 knockout rats, a pair of TALEN constructs was created that specifically target Exon 1 immediately downstream of the start of translation.
A pair of TALEN constructs was designed to target the first exon of the CSPG4 gene.
A pair of TALEN constructs for Gpr52 knockout were cloned into a mammalian expression vector pCMV-TALEN and capped, polyA-tailed mRNA for injection were produced using the Ambion mMessage mMachine kit.
CUX1 knockdown was performed by transfecting cells with a pair of siRNA constructs specific for CUX1 mRNA (5′ GAAUCUUCUCGUUUGAAACUUUGAA and 5′ GCUUCAGAGCGAUAAUACACUAUUA) using Lipofectamine2000 (Invitrogen) according to the manufacturer's instructions.
Intermolecular FRET can be easily estimated using a pair of control constructs in which either the individual fluorophores 23 (Fig. 3a, X-DI, X-AI) or tension sensor modules with one non-fluorescent mutant fluorophore 12 (Fig. 3a, X-mTSI(D), X-mTSI(are are integrated into the POI.
There is also an image of Christian Dior projected on a giant salon chair or the same technology used to show a pair of hands constructing a Dior bag.
The villas and a pair of partly constructed office towers in Dubai are still in Mr. Farnood's name, and Mr. Nazari said the transfer of the property was being held up by a 2 percent tax that the United Arab Emirates levy on such deals.
However, the anaglyph technique only requires a pair of spectacles constructed with red and blue filters where the red filter is placed over the left position producing a visual effect of 3D perception.
It also featured a new cab design with redesigned single front spectacle plates, and a pair of substantially constructed steps were fitted behind both outside cylinders to provide access to the running plate.
To evaluate the TCF/LEF transcriptional activity, we used a pair of luciferase reporter constructs, TOP Flash and FOP Flash (Millipore, Billerica, MA, USA).
