The phrase "a pair of complementary" is correct and usable in written English.
It can be used when referring to two items, concepts, or elements that enhance or complete each other.
Example: "The artist used a pair of complementary colors to create a vibrant and harmonious painting."
Alternatives: "a set of complementary" or "two complementary".
Moreover, the rats' behavioral perturbations were reflected by a pair of complementary changes in their underlying neural circuitry.
This phase plate consists of a pair of complementary phase plates with Talbot phase coding structure.
A pair of complementary thiol-modified single-stranded DNA (ssDNA) was designed and synthesized.
Relationships of the generalized word length pattern between a pair of complementary designs are established.
We developed a pair of complementary indicators called the Climate Sensitivity Index (CSI) and Climate Adaptation Opportunity Index (CAOI).
Furthermore, we give connections between uniformity and generalized word length pattern for a pair of complementary designs.
Genotypes consist of a pairs of complementary sequences, both catalytic, for which the total probability of binding both the same strand and the complementary is equal to 1 (i.e., when μ = 0, the only limit to growth is diffusion; see Materials and Methods).
To introduce the SV40 T-Ag NLS [53] at the N-terminus of the chicken Mx sequences, a pair of annealed complementary oligonucleotides with overhangs compatible with NheI and AgeI were ligated into the parental plasmids (pchMxSHK and pchMx8.1 [19]) digested with NheI and AgeI.
The outcome of the directed evolution of a pair of stereochemically complementary aldolases is illustrated schematically in Fig. 6.
Site-directed mutagenesis of ARR22 was carried out on the ARR22 Entry clones using QuikChange® Site-Directed Mutagenesis Kit (Stratagene) and a pair of fully complementary primers for the designed region GGCGAAGCTAGCTTCGACCTTATTCTAATGGAGAAGG containing D74E mutation and NheI restriction site or CGACCTTATTCTCATGAATAAGGAAATGCCTGAG containing D74N mutation and PagI restriction site.
Then, adapter-ligated fractions were amplified for 15-cycles with a pair of adapter-complementary primers to produce sequencing libraries.
