Sentence examples for a pair called from inspiring English sources

Five of her great-grand-kittens, including a pair called Fire and Flame, will be among those travelling to the Ogwen valley.

But the theme tune, an electro-pop remix by a pair called Banks and Wag, hasn't got much of a Mike Oldfield feel about it, and the pace and production values are light years from the 70s and 80s incarnations presided over by John Noakes and Peter Purves and (later) Peter Duncan and Simon Groom.

There are six architects in Shoeting Stars, including Zaha Hadid and Rem D Koolhaas, who collaborated for United Nude with a pair called the Nova.

One part of a survivin molecule unexpectedly hooks up with its counterpart on another survivin molecule, forming a protein pair called a dimer, the researchers report in the July issue of Nature Structural Biology.

Among her nine creations on view at the Visual Arts Center are a black pair called "Scissorhands," which feature Nike swooshes made of pieced-together bits of broken mirror next to a painted likeness of Johnny Depp as Edward Scissorhands (asking price: $1,500).

An alteration of a single nucleotide base pair, called a point mutation, can arise spontaneously or as a result of environmental influences such as chemical carcinogens or ultraviolet radiation.

The mutation was mapped to an interval between D16Mit58 (32.3 Mb) and a custom primer pair called 12d-4 (33.965 Mb; primer sequences: GATAGAGCACTTGGCCTGGTA and GAAAACCAATGTTTCAGTTTTCA).

When I was five years old, we had a male au pair called Gilles.

In a letter just last week, the pair called for an investigation by the DOJ's own inspector general into the department's ongoing prosecution of various medical marijuana cases in states where the substance is legal.

This group comprised worms with mutations in genes co-expressed in a single sensory neuron pair called AFD, first implicated in thermosensation (Mori, 1999).

The bars (each pair called an "arch") supported the slits, helping to hold them open.