The auction house had some trouble putting together enough pictures worthy of its evening sale, which ended on a modest score, £23.85 million, or $36.28 million.
The decentralization of inspection, resulting in varying regulations and standards results in this area receiving a modest score of 6.4, the second lowest score of all the areas.
The use of the basic reproductive number in a paper was also considered as a good indicator of MME, with a more modest score achieved (51%) that might be due to the fact that R0 is increasingly viewed as a general epidemiological concept.
Curry was enjoying a modest resurgence, scoring 19, 20 and 23 points in the first three games last week after Zach Randolph went down with a foot injury.
Overall, Jackson's tour was modest, scoring 1,097 runs at an average of 34.28 with only one hundred, made against Somerset.
Its success is illustrated by Lottich's modest scoring average of 13.3 points a game, which leads the team.
Oladipo's modest scoring average at DeMatha — 12 points — obscured his potential.
The sport has been included in every Olympics since 1912, when Lieutenant George S. Patton - later to become a famous US World War II general - controversially missed out on a medal because of a modest shooting score.
There was a modest raw score correlation (r = 0.26, n = 1382) between the two assessment measures.
Overlapping nucleotide motif queries of the hsa-miR-155 seed region (UUAAUGCUAAUCGUGAUAGGGGU) indicated a modest enrichment score for the 6-mer CATTAA that was distributed across approximately one third of the down-regulated 3'UTR space (Additional File 1 Figure S9C).
