The next step was a second (nested) PCR with a mixture consisting of 5 µl of the first PCR product and the same reagents as in the first PCR excluding RNasin® and AMV, and the inner primers RT3 (5'- ATGGCCATTGACAGAAGAAA3'), RT4 (5'- AGGCTGTACTGTCCATTTAT-3'), PR 3 (5'- andTCCCTCAGATCACTCTT-3') and PR 4 (5'- TTCCTGGCTTTAATTTTACT- 3').
To eliminate the possible influence of co-elution and other factors on the measurement of the LMWHs, a mixture consisting of twelve pure standards (n-C6, benzene, n-C7, MCH, toluene, n-C8, ethylbenzene, o-xylene, n-C9, n-C10, n-C11, and n-C12) was selected here to replace a real oil.
A mixture consisting of 70 wt.% of the active materials, 15 wt.% Super P carbon black (MMM Carbon, Brussels, Belgium), and 15 wt.% Kynar 2801 binder (PVDF-HFP, Arkema Inc., King of Prussia, PA, USA) was dissolved in 1-methyl-2-pyrrolidinone (Sigma-Aldrich, St . Louis MO, USA) solvent for uniform dispersion of the active materials on a Cu foil to obtain positive electrodes.
Dither, the ant eater, is fed a mixture consisting of a pound of raw hamburger, half a dozen hen's eggs, a can of evaporated milk, and a sprinkling of giant red ant's eggs.
Furthermore, a mixture consisting of two components is discussed.
Mice were perfused with a mixture consisting of half 4% paraformaldehyde (PFA) and half HistoChoice (Amresco).
JOL916/JOL1229 is a mixture consisting of 4 parts JOL916 and 1 part JOL1229.
For animal studies ABT-737 was slowly dissolved in a mixture consisting of 30% propylene glycol, 5%Tween80and65%65% dextrose in water.
Depositions have been carried out from a molten mixture consisting of the Ca(hfa 2tetraglyme, Ti tmhd)2 O-iPr 2, and Cu(tmhd)2 O-iPr 2 1,1,1,5,5,5-hexanduoro-2,4-pentanedione; tetraglyme = 2,5,8,11,14-pentaoxapentadeCu tmhd 2hd = 2,2,6,6-tetramethyl-3,5-heptandione; O-iPr = iso-propoxide] precursors.
The qPCR assay used a reaction mixture consisting of the following final concentration: 0.5 μ M of forward and reverse primers, 250 μ M of each dNTP (GE Healthcare, Little Chalfont, UK), 1 × HotStart Buffer (Qiagen), 1.5 m M MgCl2, 1.5 units HotStart polymerase (Qiagen), 2 μ M SYTO 9 (Invitrogen, Life Technologies), and 1 × ROX reference dye (Invitrogen).
