Sentence examples for a mixed library from inspiring English sources

The libraries comprised samples from BTx623, Rio, low Brix and early flowering F2 plants (LB/EF F2s), high Brix and late flowering F2 plants (HB/LF F2s), and a "mixed library" (Mix), where small RNAs from the previous four libraries were mixed in equal proportions.

There are currently 36,248 Sanger EST sequences available from A. fimbriata libraries made from RNA from pre-meiotic flower buds (15,759 sequences) and a mixed library from multiple vegetative tissues (20,489 sequences).

Normalized libraries were constructed separately for adult ovary and testis, along with a normalized mixed library of differentiating ovary and testis from 14 - 56 days post-fertilization.

Comparing the expression profile of AIDS-KS tissue with publicly available SAGE libraries suggested that AIDS-KS mRNA levels are most similar to those in an artificially mixed library of endothelial cells and leukocytes, in line with the description of KS lesions as containing spindle cells with endothelial characteristics, and an inflammatory infiltrate.

From previously described normalized libraries, [ 19] 9,584 additional clones were sequenced from the Atlantic salmon pyloric caecum tissue library and 60,288 additional clones were sequenced from a mixed tissue library (rgb2; Table 1).

In this study, we constructed five small RNA libraries from litchi pericarp at different storage periods and a mixed degradome library.

To understand the regulation of miRNAs on the senescence of harvested litchi fruit, five small RNA libraries of litchi fruit after storage under different temperatures and a mixed degradome library were sequenced.

The high abundance of transcripts encoding cytoskeletal proteins, creatine kinase 1, ribosomal proteins and elongation factors may be a consequence of the enrichment of cDNAs of larval origin in the mixed library (30%) since there is a complex reorganization of somatic tissues in sole larvae at metamorphosis and post-metamorphosis [ 28- 32].

Zebrafish Bili was cloned out of a mixed embryonic library (6 hpf-24 hpf) using forward primer 5' TCTCCAGCTCAGGATTTGTTGGTG 3' and reverse primer 5' TACTACCTCGAGTCAACTTTCAGTCAC 3' based on an ENSEMBLE BLAST prediction using Bili.

7pmol of each mixed library was loaded onto each flow cell.

Similar high-fidelity sequencing results for the random library are described below in the final section on the randomly mixed library.