Sentence examples for a minor sequence from inspiring English sources

The pairwise distance calculation inside the P. bucharensis group showed that the collected P. bucharensis species were identical with a minor sequence variation to strain CU_7.

To our knowledge, this is the first report of the use of HRM analysis to detect a minor sequence change in mixed PCR fragments of an EMS-treated TILLING population.

Further investigation using specifically selected probe and stringent hybridization conditions revealed that the discrete spots represented a minor sequence subfamily VG-V reported by Macas et al. [ 26] which is homogenized as a 186 bp higher-order repeat derived from five monomers (Fig. 3I).

It starts with a three chord minor sequence which changes to a four chord one during the chorus section and a bass section starts at the end of the track.

Excision of Ac/Ds elements leaves a characteristic footprint (minor sequence changes) at the donor site.

In addition, there are two Ifi202 genes and a pseudogene in the 129 mouse genome, designated Ifi202a b and c[ 20, 60], but only one Ifi202 gene in C57BL/6, which has a number of minor sequence variations from the published Ifi202a and b[ 60].

Theses categories (receptor, protein and lipid binding and catalytic and enzyme regulator activities) have proteins whose functions likely involve specific structures with particular residues contributing to their functional activities, thus a small number of minor sequence changes can change their substrate or binding properties drastically.

When we performed a blastn search of GenBank using a text string that included the minor sequence variant at both positions (ATTCTTCAAATATCTACTCATT), three of the 20 fully matching human results represented a NUMT on Chromosome 13.

They have minor sequence changes, however Type A has a repeat of the first 363 bp of the 5′ end sequence at its 3′ end sequence.

This suggests a lack of host-specificity, although minor sequence differences among strains may have gone undetected in our survey.

Cassettes that are >98% identical are generally included under a single name, but cassette variants with minor sequence differences known to affect the resistance phenotype conferred are distinguished.