Sentence examples for a germplasm from inspiring English sources

cultivars and rootstocks, originating from a germplasm collection, has been developed and validated.

The larger LD blocks within a germplasm collection are highly useful in genome-wide association mapping.

Association mapping serves as a tool to mine the elite genes by structuring the natural variation present in a germplasm.

This method was used to evaluate the pfaffic acid content in 30 different genotypes of the species from a germplasm collection.

Furthermore, the populations germplasm pool was compared to a germplasm pool of populations derived from the inter-crossing of 54 local populations in an open-pollinated field.

The experiment was conducted with 175 accessions (half-siblings progenies derived from selected plants in the field) that compose part of a germplasm collection.

The parent genotypes were identified from a germplasm screening study in which 92 genotypes were studied for Bakanae response on artificial inoculation (Fiyaz et al. 2014).

A germplasm collection of japonica rice was screened for F. fujikuroi resistance, allowing the identification of accessions with high-to-moderate levels of resistance to bakanae.

For a germplasm collection with an unknown number of alleles at a locus, such mobility data of homozygotes can be used to determine the number of unique alleles without the necessity of cloning and sequencing each allele.

Two primers namely, SC3 (Forward- GCTAGTGCAGGGTTGACACA; Reverse- CTCTGGCCGTTTCATGGTAT) and ART5 (Forward – CAGGGAAAGAGATGGGTGGA; Reverse – TTGGCCCTAGGTTGTTTCAG) were employed to conduct a germplasm survey with allele-specific markers targeting SUB1A and SUB1C, respectively.

High-resolution SNP-detection platforms are useful for generating large databases of information about SNP diversity on hundreds or thousands of lines from a germplasm collection or breeding program.