Sentence examples for a forward sequence from inspiring English sources

The phrase "a forward sequence" is correct and usable in written English.
It can be used in contexts related to order, progression, or arrangement, such as in mathematics, programming, or data analysis.
Example: "In the algorithm, we need to process a forward sequence of numbers to ensure accurate results."
Alternatives: "an advancing sequence" or "a sequential order".

Exact(2)

Specifically, they showed that individuals at familial risk for bipolar disorder develop the illness in a forward sequence of clinical stages: evolving from non-mood disorders followed by minor mood disorders, then major mood disorders, and finally bipolar disorder (Figure 1). Figure 1 Proposed stages for bipolar disorders.

The algorithm imitates the Euler path algorithm but maintains both a forward sequence and a reverse complement sequence simultaneously.

Similar(58)

The Vaginal Human Microbiome Project protocol uses a forward sequencing orientation of V1-V3 16S readsreads.

The sequence contig of sample FRE228 mistakenly contained a forward sequencing read of sample FRE208 with the HVS-II motif 204C 26315.1C.1C, which led to an artificial recombinant in the consensus sequence reported for FRE228.

Guanine (or cytosine if a forward sequencing primer is used) is incorporated during pyrosequencing if the template CpG was methylated, while adenine (or thymine) is incorporated if the template CpG was unmethylated.

Thus, for shorter 16S rDNA sequences that do not cover the entire targeted V1-V3 region, sharper distinctions between different species of lactobacilli are afforded by a forward sequencing orientation (i.e., V1 to V3) of 16S rDNA amplicons compared to a reverse sequencing orientation (i.e., V3 to V1).

The primers of katG gene forward sequence (5′-A A A C A G C G G C G C T G G A T C G T 3′) and reverse sequence (5′-G T T G T C C C A T T T C G T C G G G G 3′) were used to generate a 209 bp fragment encompassing the S315T codon [ 24].

This is actually a fairly straight forward sequence.

This particular location at one point had a "pay it forward" sequence that lasted through 141 customers.

The last column indicates the filenames of the corresponding FASTQ files available at Sequence Read Archive, appended with an "F" for the forward sequence read or an "R" for the reverse sequence read.

For CHOP RNA (NM024134), the forward primer was CCAGCAGAGGTCACAAGCAC and the reverse primer was CGCACTGACCACTCTGTTTC. Rat β-actin RNA was used as an internal control; the forward sequence was GACATCCGTAAAGACCTCTATGCC and the reverse sequence was GAGACACACCTAACCACCGAGATA (173 bp; GI38648901).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: