Your English writing platform
Discover LudwigThe phrase "a current release of" is correct and usable in written English.
You can use it when referring to the latest version of a product, software, or publication that is currently available.
Example: "Make sure to download a current release of the software to access the latest features and improvements."
Alternatives: "the latest version of" or "an up-to-date release of".
Exact(1)
Using antibody-based immunoassays to detect target proteins, the Human Protein Atlas [51] has been created to facilitate targeting proteins from more than 15,000 human genes (∼75% of the human protein-coding genes, a current release of 11 March 2013 [52])).
Similar(59)
Popular draws are the double bills – usually, two films that would appeal to a similar audience, one of which may be a current release not long out of the multiplexes, providing great value for money.
This gene does not appear to contain any signatures of the currently known HMMs for GTs and might represent a false negative of our analysis or an erroneous annotation in the current release of the L. rhamnosus GG genome NC_013198.1.
The current release of miRBase contains a sequence annotated as miR415 with two entries, one in A. thaliana (aacagagcagaaacagaacau) and another in rice (aacagaacagaagcagagcag).
A similar 'wildcard' scoring option is available in the current release of RMAP.
This means that users can upload identifiers from an older version, which are converted into the most current release of identifiers.
However, our analysis is based on the current release of the E. guineenis genome [ 39] and an improvement of both the overall quality of genomic sequences and scaffold size of the assembly are necessary before this assumption can be confirmed.
Jason F. A. Jason F., here is the most current release of information about the Twitter archive from the Library of Congress.
The current release of Shape meets those goals very well.
The current release of the Mozilla browser is version 1.6, and it's an interesting product.
This paper introduces and describes the latest and current release of the Energy ADE, version 1.0.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com