Your English writing platform
Free sign upThe phrase "a correct sequence of" is correct and usable in written English.
It can be used when discussing the order or arrangement of elements that are deemed accurate or appropriate.
Example: "To solve the puzzle, you need to follow a correct sequence of numbers."
Alternatives: "an accurate order of" or "a proper arrangement of".
Exact(2)
For example, although students are fairly accurate in identifying a correct sequence of events in Earth's geologic history (Trend, 2001), they fail to understand the magnitude of time between events (Tretter et al., 2006).
In 4 out of 25 runs with local feedback and 1 null model run a lineage evolved that was capable of outputting a correct sequence of 64 bits for a specific resource, as one can also observe in Figure 6.
Similar(58)
On average, we obtained a correct sequence for 50% of the clones.
As illustrated here, AdvISER-PYRO is expected to substantially help improve the reading and translation of the into a correct sequence or set of sequences in case of SAS and MAS signals, respectively.
The constructs were transformed into MC1061 cells, and transformants were screened for the presence of a correct sequence by using PCR primers CAGATGAAATGGGTAAGTAC and AAACCCTAACCACCGCTTAA.
The participant is asked to draw a line between the correct sequence of numbers and letters in circles on a paper as fast as possible.
In one family, a stop codon was introduced after Arg236 and in another family the correct sequence of ACE was through Pro402 - mature somatic ACE numbering [10].
But the repair would be possible only if the plant possessed an undamaged copy of the gene from which to restore the correct sequence of DNA units.
Within the ventricles, a specialized conduction system called the Purkinje network serves to facilitate the timely and correct sequence of activation of the ventricles.
The correct sequence of all the three plasmids were confirmed by sequencing using RP951, RP952, VP5, and VP6 primers.
Exchange-PAINT relies on the fact that DNA strands with the correct sequence of letters, or nucleotides, bind specifically to partner strands with complementary sequences.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com