Sentence examples similar to a control corresponding to each from inspiring English sources

The upper limit of allele size that can be successfully detected should be known, and a control corresponding to that size should be included in each run.

For each of these three experiments, a control corresponding to L3 (G0) aphid fed on an artificial diet without EMS and made of six replicates also was performed.

Each sample was evaluated in triplicate, and each experiment contained a negative control corresponding to the RLU values obtained with empty HIV-1 pseudoparticles.

Each sample was evaluated in triplicate and a negative control corresponding to the fluorescence intensity obtained with HeLa cells transfected with pVITRO2-blasti-mcs-tat.

A scramble control corresponding to sequence #1 GAAGACTACCACGACTTATAT was cloned into the pLKO.1 vector according to supplier's protocol (Addgene).

Hsp72 shRNA sequence #1 (GGACGAGTTTGAGCACAAG), a scramble control corresponding to sequence #1 (GGACGAGTTGTAGCACAAG), and shRNA #2 GCCATGACGAAAGACAACAAT) were cloned into the pLVTHM vector as described previously [19].

In addition, a vehicle control corresponding to the highest DMSO concentration, which did not exceed 0.2% (v/v), was also prepared.

where both MTs are at the cell's edge and perfect average power control, corresponding to a scenario with strong interference between MTs at both BSs.

Four mutations distinguished the sequence of the positive control corresponding to a French bat (No. 2002FRA) from the different sequences obtained from Spanish bats (not shown).

c, Levels of H3K27me3 and pan-H3 nuclear loading control corresponding to Supplementary Fig. 3d.

This approach revealed that 1% to 0.1% of cells were viable compared to the non mineralized control, corresponding to 104 to 105.ml−1 cells (106 cells.ml−1 in the mineralization vials, Table 1).