Sentence examples for a complement of a from inspiring English sources

Notice that this doesn't tell you that your complementation has to be classical, but it does tell you that a complement of a set should be a set.

Let L be a lattice with top element 1 L and bottom element 0 L and let a, b ∈ L. Then b is called a complement of a, if a ∨ b = 1 L, and a ∧ b = 0 L. If a ∈ L has a complement element, then it is unique.

MMP-2 shRNA contains a complement of a 21-nucleotide sequence (tgtgctgaaggacacactaaa, GenBank NM-004530), which was separated by a 7-nucleotide non-complementary spacer (CCACACC).

First, it is dubious at best that the combination of complexity and genetic stability required of an even a minimal cell – a complement of a few hundred genes that is accurately transmitted over many cellular generations – is attainable with an RNA genome.

The aim of this work was evaluate the effects of a probiotic fermented milk as a complement of a re-nutrition diet, on the recovery of the intestinal barrier, and mucosal and systemic immune functions in a murine model of non-severe protein-energy-malnutrition.

The aim of the present work was to evaluate the effects of a probiotic fermented milk (PFM) as a complement of a re-nutrition diet, on the recovery of the intestinal barrier, histological alterations, the mucosal and systemic immune functions and its protective effect against Salmonella enterica serovar Typhimurium (S. Typhimurium) infection, using a model of non-severe PEM in mouse.

Consequently, six formulas equate a function of the complement of A to the corresponding cofunction of A (see table).

The 75-acre estate of David Rockefeller, who died in March, includes a Georgian-style mansion and a complement of buildings for a gentleman farmer.

Each bench was equipped with a complement of cutting tools, a vicelike metal press, semicylindrical plastic cigar molds and stacks of tobacco leaves.

Chicago is a place where the lakefront is a complement of the city, not an escape from it, where city and lake seem suited for each other.

The sculpture travels with a 50-page instruction manual, a complement of tools and Mr. Burden's assistant, Spencer Stair, who has the piece memorized.