Sentence examples for a common sequence for from inspiring English sources

Exact(1)

We did not examine miR-133b because it was considered to function similarly to miR-133a; these microRNAs have very similar sequences (miR-133a: UUGGUCCCCUUCAACCAGCUGU, miR-133b: UUGGUCCCCUUCAACCAGCUA) and have a common sequence for binding to FSCN1 mRNA (UUGGUC).

Similar(59)

This problem has interesting application for finding a common sequence from two mutated sequences.

Furthermore, a common sequence of constraint evaluation is used for all the solutions.

These findings suggest that the variable nucleotides immediately flanking GC42 are likely the co-conversion tract of GC42 insertion, a common sequence mark of insertion for many mobile sequences, e.g., group I and group II introns (Lambowitz and Belfort 1993; Moran et al. 1995; Sanchez-Puerta et al. 2008).

The number of b-values and their values at low diffusion-weightings was limited by the requirement for a common sequence across a wide range of clinical platforms for implementation in a multicentre trial.

Homology search for a common sequence motif overrepresented within SARs yielded two consensus motifs of 328 bp and 296 bp representing Alu repeats of subclasses AluS and AluY, respectively.

This set of SRAP primers sharing a common sequence part were easily used for tagging SRAP PCR products and even two ends of SRAP PCR products in the second round of tagging PCR.

As the Broad Institute authors note, "Mobile elements provide an elegant mechanism for distributing a common sequence across the genome, which can then be retained in locations where it confers advantageous regulatory functions to the host -- a process termed exaptation".

Finally, a common sequence element appears to be critical for enabling KlARSs to function in both L. kluyveri and S. cerevisiae because all 25 KlARSs that function in S. cerevisiae also function in L. kluyveri (p-value of 0.002).

Furthermore, HLA-B*45 involvement suggests that the common sequence for the antigen group may anchor parasite peptides and trigger a protecting response.

Calculation of cell number was determined based on real-time PCR for gene encoding eukaryotic18S rRNA (Hs99999901_s1, Taqman, Applied Biosystem) with common sequence for human and mouse.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: