Parameters (i.e. their significant counts) were added in a linear combination to generate weighted trends.
Consider now two pieces of evidence on the same frame H represented by two bpa m1 and m2 Decision maker needs a rule of combination to generate a new bpa.
Electrons transfer from the bound substrate radical to the [4Fe 4S]2+ to which it is bound, accompanied by radical combination to generate a C=O double bond, or a C=S double bond that hydrolyzes to C=O, yielding formylglycine.
Primers EphplgroEL 569)F (ATGGTATGCAGTTTGATCGC), EphplgroEL(1193 R (TCTACTCTGTCTTTGCGTTC), and EphgroEL(1142 R (TTGAGTACAGCAACACCACCGGAA) were designed and used in combination to generate a heminested polymerase chain reaction (PCR) for the selective amplification of 573 bp of the groEL gene of A. phagocytophilum.
We used the following search keywords in different combinations to generate a list of potentially useful studies: "schizophrenia" (as well as variants, including "psychosis" and "schizoaffective"), crossed with "antipsychotics", "antipsychotic agents" or "neuroleptics" and neuroimaging stems, including "MRI", "magnetic resonance imaging", "VBM" and "voxel-based morphometry".
At the initialization stage, multiple strategies are utilized in a combination way to generate the initial solutions.
Finally, globally similar models and/or locally similar model fragments are combined using a novel model combination algorithm to generate refined models.
This paper shows how airborne imaging hyperspectral data collected over weathered peridotite rocks in vegetated, mountainous terrane in New Caledonia were processed using a combination of methods to generate a regolith-geology map that could be used for more efficiently targeting Ni exploration.
We employed a combination of methods to generate data, and consistent with such a problem, we employed principles of Grounded Theory to analyze the data [ 12].
Sales of major labels like EMI's Virgin Records and BMG's RCA have been ruled out on the grounds that such divestitures would greatly erode the $290 million in savings a combination is expected to generate, people close to the discussions said.
The following box summarizes all the combinations utilized to generate crop yield estimates.
