Sentence examples for a combination of usable from inspiring English sources
VisArchive represents this contextual information using a combination of usable, visual, and interactive components to better support searching, browsing and exploring project archives.
In order to maximize usable returned sequence data, a combination of three primers were utilised separately for each clone: C.elegans RNAi F from the Source BioScience library, forward 5′ ggagaccggcagatctgata, and reverse 5′ ggcctcttcgctattacgc.
These wastes are processed through a combination of biological, physical and chemical systems to render harvested biomass into usable or recoverable materials.
The power of this technique was demonstrated when a usable human draft genome assembly was produced using a combination of differently sized short read jumping libraries (180 bp to 40 kb) with the ALLPATHS-LG assembler [ 10].
Plasma arc gasification (PAG), waste-treatment technology that uses a combination of electricity and high temperatures to turn municipal waste (garbage or trash) into usable by-products without combustion (burning).
Decontamination is a combination of processes including cleaning, disinfection and/or sterilisation used to make a re-usable item safe to be handled by staff and safe for further use on patients.
A combination of the above?
Usually it is a combination of both.
It is a combination of factors.
