Sentence examples for To the leftmost from inspiring English sources

One explanation for this contradiction is the party's self-imposed confinement to the leftmost portion of the electoral battleground.

A typically good ROC always shifts to the leftmost corner.

The hyperpath corresponding to the leftmost tree in Fig. 1a is highlighted in red.

The detection order in HP is from the rightmost column to the leftmost column.

During the whole BP iteration process, soft messages are updated and propagated among adjacent nodes from the rightmost column to the leftmost column.

Moving from the rightmost to the leftmost pairs of curves, each pair corresponds to an incremental increase in N r from 2 to 6.

Then add some hair to what used to be the leftmost strand (now center) from the left side.

That is, the birds had to peck the leftmost tumbler first, followed by second tumbler located to the right of the first, and so on until all four tumblers had been responded to.

Alignment results are subsequently trimmed to encompass the leftmost and rightmost ungapped block of at least 6 nucleotides.

Four PCR primers DupOL (ggtaatacttgcaccaacggt), DupOR (catacgaacatcgcggactcc), DupIR (cgatagacagacattggcaac) and DupIL (gagaaagattttggcgggaac)–were designed to amplify the leftmost boundary of the leftmost duplicon, the junction between these two copies, and the rightmost boundary of the rightmost duplicon.

The dynamic response of the system to a harmonic excitation at the leftmost oscillator is considered.