Sentence examples for In shine from inspiring English sources

Also you could purchase a deep conditioner, or use a home remedy, to lock in shine.

In SHINE, VHWs are dually supervised; (1) by Ministry of Health and Child Care nurses in carrying out their regular duties, and (2) by SHINE research staff in carrying out the additional tasks required by the trial.

In Shine, she, like silent Rosa, has truly found her voice.

In "Shine So Bright," which starts his second album, "Separate Ways," he dreams of being a high-maintenance rock star: "No one will talk back/ 'Cause you never know when I'll snap".

In "Shine Eye Gal," one of Mr. Levy's first hits, he complained about a fickle girlfriend by listing her many desires: "You want uptown, you want downtown/You want fancy car, you want superstar".

In "SHINE," a video produced by The Goddess Project, 10 women came together to discuss their body insecurities and how they are learning to love themselves.

In SHINE, FOI is operationalized to include the delivery process (how regularly and timely intervention commodities [latrine, soap, LNS] are delivered, and what VHWs do), the quality of delivery (how well they do it), and participant responsiveness (how households respond) [ 40].

These are commonly found in conditioner and leave-in shine products.

VHWs were trained in SHINE-specific modules in separate groups according to the randomized allocation of the cluster in which they live and work.

Sequences of consecutive guanines are sometimes interrupted by adenines, as shown in UGGGGGGAGGGAGGGAGGGA of the 3'-untranslated region of chicken elastin mRNA (6), and GGAGG in Shine-Dalgarno sequence (7).

She may have left the family business, but the family business has not left her, with BSkyB an 8% shareholder in Shine Group, along with Sony Pictures Television International and venture capitalist 3i.