I was inserted

USAGE SUMMARY

The phrase "I was inserted" is correct and usable in written English.
It can be used in contexts where someone is discussing being placed or included in a situation, system, or narrative. Example: "During the meeting, I was inserted into the conversation to provide my perspective on the project."

✓ Grammatically correct

Science

News & Media

Human-verified examples from authoritative sources

Exact Expressions

4 human-written examples

This example reads naturally and flows for the reader, whereas if an "I" was inserted at the start, while not hugely different, it would read more like a list.

The Guardian

To this end a double PCR product digested with Mlu I and Xho I was inserted into the same sites of pcDNA.

Plosone

To make the pIRES-DHFR vector system, the DHFR gene digested with Sal I and Not I was inserted into MCS-B site separated from MCS-A by an internal ribosome entry site (IRES) sequence (581 bp) in the pIRES vector (Fig. 1A).

Plosone

To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.

BMC Genomics

Human-verified similar examples from authoritative sources

Similar Expressions

56 human-written examples

For this, all combinations of occurring loads μ and MCS i are inserted into Eqs.

EURASIP Journal on Wireless Communications and Networking

Assume that each vector tree T i is inserted with one encoded bit e i (e i  = 0, 1).

EURASIP Journal on Advances in Signal Processing

The two Galileo copies: (i) are inserted in opposite orientation; (ii) present exchanged target site duplications; and (iii) are both chimeric.

Plosone

Then the occurrence i is inserted into the list L w ′.

Algorithms for Molecular Biology

Let Δ (i, r, s ) denote the difference in objective function value if request i is inserted at its best position into route r of solution s.

Computers and Operations Research

"And I was doing something that they found even more unappealing: I was inserting myself into the case".

The New Yorker

So when I sat down a couple of years ago and started writing a book of memoirs, I believed I was inserting myself in its history.

Huffington Post

Expert writing Tips

Best practice

Use "I was inserted" when you want to emphasize that you were placed or included into something, especially if it happened passively or without your direct control.

Common error

In very formal or professional writing, consider using more sophisticated synonyms like "I was integrated" or "I was incorporated" to avoid sounding too passive or informal. Check that the tone and formality of the text is appropriate for the audience.

Linguistic Context

The phrase "I was inserted" functions as a statement describing a past action where the speaker was placed or included into something. This aligns with Ludwig AI, which confirms its correctness and usability. It describes a passive role.

Expression frequency: Uncommon

Frequent in

Science

50%

News & Media

37%

Wiki

6%

Less common in

Formal & Business

0%

Encyclopedias

0%

Reference

0%

Ludwig's WRAP-UP

The phrase "I was inserted" is grammatically correct and usable, indicating a passive inclusion or placement into something. While Ludwig AI confirms its correctness, its frequency is uncommon, primarily appearing in scientific and news media contexts. Alternative phrases like "I was included" or "I was added" offer similar meanings with slight variations in emphasis. When employing "I was inserted", consider the context and formality of your writing to ensure the most appropriate tone. Overusing it in very formal texts could sound too informal or passive, where synonyms might enhance the sophistication of your prose.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

I was added

Simple and straightforward alternative to "I was inserted".

I was integrated

A more concise and direct way of saying "I was inserted", focusing on the integration aspect.

I was incorporated

Suggests a more formal or systematic inclusion.

I got included

Replaces "was inserted" with a more informal verb, "got included".

I was introduced

Focuses on the act of being presented or brought into a situation.

I became a part

Uses a more general phrase to indicate involvement or inclusion.

I was brought in

Informal way of indicating inclusion or involvement.

I found myself placed

Emphasizes the speaker's passive role in being located somewhere.

I ended up being positioned

Suggests a final state or arrangement, and uses the passive voice.

I happened to be integrated

Emphasizes chance or coincidence in becoming integrated.

FAQs

What can I say instead of "I was inserted"?

You can use alternatives like "I was included", "I was integrated", or "I was added" depending on the specific context.

How do I determine if "I was inserted" is appropriate for my writing?

Consider the formality of your writing. "I was inserted" is acceptable in many contexts, but more formal situations might benefit from alternatives like "I was incorporated" or "I was integrated".

Is there a difference between "I was inserted" and "I was included"?

While similar, "I was inserted" often implies a more specific or deliberate placement, whereas "I was included" suggests a broader sense of belonging or being part of a group.

When should I avoid using "I was inserted"?

Avoid using "I was inserted" if it sounds awkward or unnatural in the context. In some cases, simpler alternatives like "I was added" or "I became a part" might be more appropriate.