B i ⋅ q Forward multiplier of sector i, weighted by employment or labor income.
Following primer pairs for GAF519-Q (Forward- CGC GGATCCTGATGCAAGGTGTGCT, Reverse- TATTAT CCGCGGCTGCGGCTGCGGCTGTT) and GAF582-Q (Forward- AAGAA GGATCCATGGATGCCCAGCAA and Reverse-TATTAT CCGCGGGAGAGTCTGTTGTGTTTG) were used where Bam H I in the forward and Sac II in the reverse primers are underlined.
B i ⋅ q σ Forward multiplier of sector i, weighted by employment or labor income and by share of overall factor income.
One can rewrite (12), by using the q-forward and backward jump operators (10) as Δ x 2 f ( x ) = ( E q + E q − 1 − 2 ) f ( x ).
Here E q and E q − 1 are q-forward and backward jump operators, respectively acting as E q f ( x ) = f ( q x ), E q − 1 f ( x ) = f ( x q ).
Q: What can I expect going forward?
The (q,omega -forward jump operator,omega -forwardkward jump operator, and (q,omega -backwardgraininess function are defined by begin{aligned}& sigma_{q,omega -backwardmega, qquad rho_{q,omega}(t):= frac {t-omega}{q},quad text{and} & mu_{q,omega}(t):=t(q-1)+omega, quad text{respectively}.
Forward and reverse primer pairs were designed for Nestin and 18S rRNA as follows: Nestin-Q-PCR (forward: 5′-GGAAGAGTCTGACCCTGT-3′ reverse: 5′-AGACTAGCGGCATTCCTT-3′) and 18S rRNA Q-PCR (forward: 5′-CCTGGATACCGCAGCTAGGA-3′ reverse: 5′-GCGGCGCAATACGAATGCCCC-3′).
For semi-quantitative (semi-q) PCR, forward primer 5′AGAGGGTGGGAAAAACAAAAACAC3′ and reverse primer 5′AAAACCACGAAATCGTCTTCACTT3′ were designed using PrimerSelect (DNASTAR, Madison, WI, USA).
