Sentence examples for Fresh components from inspiring English sources

Exact(1)

Back at the start, Drane experimented with fresh carrots but quickly gave up on that, since fresh components didn't work within the constraints of the processed-food system, which typically required weeks or months of transport and storage before the food arrived at the grocery store.

Similar(59)

But if Soothing Sounds for Baby has a fresh component, it's a generosity of spirit.

This approach assists with meeting an expanding demand for intravenous Ig but may result in fresh component losses and be associated with considerable cost.

Furthermore, the assignment of ESTs and genes to specific pathways provide a fresh collection of novel components that can be further explored in functional assays during embryonic development and in human diseases.

This identifies potential novel components of cytoplasmic dynein 2 and furthermore provides fresh insights into the molecular pathogenesis of human skeletal ciliopathies.

Ordered medium-rare, grilled sirloin was overdone; and while the broth for classic Romagnola seafood soup was terrific, its fresh seafood components seemed cooked out, having perhaps released all their flavors to the broth.

No fresh juvenile components such as pumice or scoria were found in any of the samples.

Acquisition of fresh cellular components is thought to be balanced by apoptosis and shedding of aged nuclei.

The syncytiotrophoblast exists in a terminally differentiated post-mitotic state; it is generated and renewed from the underlying population of mononuclear cytotrophoblast cells, which undergo proliferation, differentiation and finally fusion with the syncytiotrophoblast, permitting the acquisition of fresh cellular components.

However, this strategy may have added strain on the inventory available to meet clinical demand for fresh blood components and was associated with a cost to the Blood Service of >1 million Australian dollars.

Next 1 μL of this mixture was transferred to a tube containing 24 μL fresh reaction components and the inner pair of nested primers (forward: GGAGGCTGAGTAGTAACTGAGAACCCTC, reverse: GTGAAAGTGTCCTCAAGGCTACCACCTTC) to generate a final PCR fragment 11,211 base pairs long.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: