Your English writing platform
Discover LudwigSuggestions(1)
Exact(48)
Lane 1: BamHI (cut at nt 417) and XmnI (cut at nt 2298) double digestion on pUC19 generated the 1.9-kb and 0.8-kb bands.
Higher litterfall production was found at TC and TN than at NT.
The caffeine-induced demethylation at nt −682 in StAR promoter underwent a similar time course as StAR expression does.
(F) Sanger sequencing results showing a heterozygous mutation (A/G) at nt 75 (red arrow) in RCAN1.4.
The RNAi sequences were GGACGGAGGCTGATTTCGAAGAGAA (start site at nt 38), GATTTCGAAGAGAAGTGCACGTACA (start site at nt 49), and CCTTGCCAAGGAACTTGACTTTCAA (start site at nt 137).
None of the individuals were carriers of the mutations at nt 385 (weak secretor) or at nt 571 in the FUT2 gene.
Similar(12)
There was a significantly lower probability of death at NT-proBNP below 8548.5 pg/mL.
Alan Stacey, the Young Vic's commercial director, said: "We've looked at NT Live, and wouldn't rule out that model.
Profits came in at NT$1.25 billion ($41.63 million), below analyst expectations, with earnings per share after tax standing at NT$1.50.
Base fare starts at NT$126, compared to NT$70 for regular Taipei taxis.
HTC Corp closed down 2.99% on the day, ending at NT$130 on the Taiwan Stock Exchange.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com