I annotated the certificate of insurance and returned it to be amended in the envelope provided.
Initially, the genes for the study of M. hyopneumoniae promoters were chosen based on two criteria: (i) genes annotated as hypothetical were excluded, since it was not known whether they were transcribed and (ii) genes chosen had a divergent upstream gene, thus ensuring that they did not lie inside an operon, and that, consequently, there was a promoter immediately upstream of them.
One R.PabI homolog (annotated as two proteins, ETD23441 and ETD23442) was disrupted, but the other R.PabI homolog (ETD23519) and both M.PabI homologs (ETD23443 and ETD23518) appeared intact.
First, zma-miR166b, c, d, e, h, and i are annotated as 22-nt (UCGGACCAGGCUUCAUUCCCC), while zma-miR166a is annotated as 21-nt (UCGGACCAGGCUUCAUUCCC).
For the two large duplicated gene groups, 86% of the duplicated genes in Group I were annotated as VSP function, while in Group II 72% of the genes were annotated as Ank function and 27% as Pkinase (See Additional file 1 for functional domain annotation).
The newly detected bacterial type I metacaspases (annotated as GSU0716 from G. sulfurreducens, in β-, δ-Proteobacteria, andiNitrosporaeand Nitrosporae but missing in α-Proteobacteria) have p20 and p10 domains but no prodomain; this is similar to type I metacaspases from phytoplankton.
After returning from my first Amazon trip, my copy of "Tristes Tropiques" by then heavily underlined and annotated, I tried to devour as much of Mr. Lévi-Strauss's work as I could find, in whatever language was available.
I told Mary Ellen (as I always had referred to her) I can go print out some high res images taken by the Hubble Space Telescope and annotate them for her if she liked.
Below, I've annotated the press release.
But labor contracts like the ones I've annotated still abound.
I've annotated it with a few extra facts.
