Sentence examples for And imi from inspiring English sources

Throughout this report, we use the term "subclinical mastitis" to describe cases of mastitis defined by SCC measures, and "IMI" or "subclinical IMI" to describe cases of mastitis defined by bacteriologic culture.

Four categories of adherence to MD were considered, ranging from low (0 2 points for MDS and IMI) to high (>6 points for MDS and ≥5 points for IMI) adherence.

Morgan Crucible Company, which also makes industrial ceramics, was down 21.7p at 257.8p while Bodycote International fell 20.1p to 391p and IMI dropped 23p to 948p.

Roberto Quarta has for a while been chairing two FTSE 100 companies – Smith & Nephew, the healthcare group, and IMI, the engineer.

The German confidence survey gave a lift to industrial groups including GKN, up 4p at 218.4p, and IMI, 17p better at £10.17.

And while Credito Italiano, a bank, and IMI, a financial conglomerate, have delivered positive returns to investors, they have badly trailed the Milan stockmarket.

Seven primer pairs, newly designed from 44 β-lactamase genes encoding extended-spectrum β-lactamases not related to TEM- and SHV-types, were used to differentiate OXA-2, FOX-3, CMY-3, IMP-1, and IMI-1 β-lactamases.

The complete coding sequence of blaIMI was further amplified with an additional pair of in-house designed primers, IMI-up (CTGGCACGCATAGTAACCCA) and IMI-dw (ATGCCGAAAGTGCAAGCCT).

† Enterobacter asburiae MS7 produces acquired β-lactamase IMI-2, whereas E. cloacae 1413B produces acquired β-lactamases TEM-1 and IMI-1 (5 ).

E. cloacae NOR-1 and E. cloacae 1413B were used as strains that produce the chromosome-encoded, clavulanate-inhibited carbapenemases NmcA and IMI-1, respectively (5, 8 ).

An 818 bp internal probe for blaIMI-1 was obtained by using primers IMI-A (5´-ATAGCCATCCTTGTTTAGCTC-3´) and IMI-B (5´-TCTGCGATTACTTTATCCTC-3´) and standard polymerase chain reaction (PCR) amplification procedures (5, 26 ).