Sentence examples for And hrd from inspiring English sources

The Russian study explained that growing unemployment, wage reductions, and maladjustment to stress in men resulted in increasing HRD, but that the causal relationship between economic difficulties and HRD could not be explained.

and the channel matrices Hsr and Hrd are estimated by means of a BALS algorithm.

The channel variances of Hsd and Hrd are defined by δsd2 and δrd2, respectively.

Consequently, Hsr, Hrr, and Hrd can be recovered in an essentially unique manner up to scaling factors.

Moreover, the Rayleigh fading channel coefficients Hsr(n), Hsd(n), and Hrd(n) are assumed to be independent random variables.

HRD department can be established and HRD professionals can be hired to assist the managers in organizing training and development programs.

The electrochemical activities, capacities, and HRDs of ZrMn0.5V0.4Ni1.1Crx alloy electrodes are worse than that of matrix alloy.

The full genomic region of hrd-1, gene-to-gene, was amplified by PCR in two fragments for sequencing, using the primer pairs hrd-1-F1 (ATTGATATGGCACATTCAGAGCTTG /hrd-1-R1 (GTTGTTGTGGAAATCCAAACTGATG), and hrd-1-F2 (CATTGTCTCCGCAGTTGGTTCC /hrd-1-R2 (CATCGTCCTCTTTTTGTTCTGCTG).

Table  2 presents the results of a three-term multivariable logistic regression including HRD-LOH, HRD-TAI, and HRD-LST scores as predictors of BRCA1/2 deficiency.

In univariate logistic regression analysis, each of the HRD scores (HRD-LOH, HRD-TAI, and HRD-LST) was significantly associated with BRCA1/2 deficiency (Table  1).

Pairwise correlations of the HRD-LOH, HRD-TAI, and HRD-LST scores were examined graphically, and quantified with Spearman rank-sum correlation.