Sentence examples for According to cases from inspiring English sources

According to cases 1, 2, and 3, simulation results show that v fs is also approximately equal to r/∆T, although there are changes in contact duration of virus, communication radius of node, distribution density of node, and the number of initial infected nodes.

The elapsed times for the peak were different according to cases.

Then local stable and unstable manifolds of the origin exist according to cases (a)–(d) given below.

Note that according to cases (a) and (b), shown in expressions (9) and (10), the frontier between regions (II) and (III) is determined by the equation ( z=4k-3 ).

The incidence rate of goat melioidosis was low in the south, where the incidence of human infection has not been defined but appears to be low according to cases reported in the literature (12 – 12 ).

If the IME-EF4 has the protruding cohesive end situation according to cases 1, then there would be signals after either the terminal sequence GAGATTCGTTTAAGCGAAAG, ATTTTTTGAAGAAACTAATA, or both of them in the terminal run-off sequencing result.

Her father and mother were very young and entirely unprepared for parenthood, according to Case.

To estimate the risk of postoperative complications in robotic-assisted gynecologic surgery according to case type.

According to case reports, dysphagia or airway obstruction resulting from DISH is a rare occurrence.

Homes there lost more than half their value, according to Case-Shiller data.

Not every market is showing improvement on the low end, according to Case-Shiller.