Sentence examples for A standard quantity of from inspiring English sources

A standard quantity of 3H-thymidine-labeled Enterococcus faecalis (3.70 × 104 cpm, 2.0 × 107 colony-forming units) was used to inoculate the mesiobuccal canals of 50 extracted mandibular molars.

A standard quantity of electricity generation (Q_{text{E}}) is set to 2165 GWh such that all RES produce the same average annual output.

At Proton Energy, a Connecticut company that builds the electrolyzing machines that use current to produce hydrogen, Walter Schroeder, president and chief executive, laid out the problem in terms of dollars per million B.T.U.'s, a standard quantity of heat in the fuel business.

Of the remaining 44 teeth, 22 then were instrumented with GT and Profile (Dentsply/Tulsa Dental Co, Tulsa, Okla) instruments to apical size #35 (group 1) and 22 teeth with Pow-R instruments (Moyco/Union Broach, York, Pa) to apical size #50 (group 2), in the presence of a standard quantity of phosphate-buffered saline solution placed in the canal.

Indeed, there was a significant, negative relationship between the time it took to capture and consume a standard quantity of shrimp and both maternal size (Fig. 1; slope  = −0.14 ± s.e. 0.048) and tadpole size (Fig. 2; slope  = −0.217 ± s.e. 0.031).

Standard quantities of interest that help to characterize the topology and complexity of networks49, 53 include node degree, geodesic distance, clustering coefficient, and local and global network efficiencies.

Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA.

Standard quantities of 2X PCR Master Mix and SuperScript III RT/Platinum Taq Mix were added to the mixture reaction containing 0.8 µM of each primers (GRswH1-349Fw GAGCTAAGAGAGCAATTGTAGATGGATGGTGAATGTandTGGATGGTGAATG) and 0.2 µM of the probe (GRswH1-538Probe TTGCTGAGCTTTGGGTATGA [5']Fam [3']BHQ-1).

Standard quantities of intact total RNA or mRNA were reverse transcribed and subjected to Q-PCR.

Individual sample differences were calculated based on the ratio of standard quantities of gli1 and gapdh transcripts determined by the standard curve method.

A standard curve between quantity of RL7-11 and size of OSZ could be obtained based on this method.