Sentence examples for A sc from inspiring English sources

A SC ontology is a first step towards achieving a standard description of SC design and management processes.

A SC MgF2 window with a fineness ratio (F) of 1.33 is designed as an example.

A SC algorithm based on a normalized Laplacian matrix L rw is used in this paper.

A SC < 690 or a (D30/60) < 250 during a SST were more sensitive than a SC of < 550 nmol/l in detecting AD (89% vs 74%).

A SC classification model was developed using multinomial logistic regression via LASSO.

A SC MO (SC: CCTCTTACCTCAGTTACAATTTATA) (Gene-tools, LLC) was used in parallel, as a negative control.

Aedanus Burke (A-SC) proposed that "vicinage" be replaced by "district or county in which the offence has been committed".

A non-targeting siRNA-A sc-37007 was used as a negative control.

Control siRNA-A: sc-37007 (Santa Cruz Biotechnology, CA) was prepared based on the manufactures instructions.

Control siRNA-A: sc-37007 (Santa Cruz Biotechnology, CA) was also prepared based on the manufacturer's instructions.

Furthermore, a preliminary displacement based design approach for a SC-RW system is introduced.