Sentence examples for A aso from inspiring English sources

Suggestions(2)

Exact(2)

Fig. 1 a Aso caldera and Nakadake volcano in north-central Kyushu.

It also entailed correcting a perceived wrong (e.g., when all ASO board members were gay men, one participant who was a user of drugs decided to become a ASO board member to represent the needs of his peers), and providing publicity about the work of the ASO and the needs of ASO clients.

Similar(58)

As a control, we used an ASO with a mismatched sequence 5'CCTTCCCTGAAGGTTCCTCC3'.

Two participants stated that often people recognize their fit with an ASO when they attend events with ASO staff or volunteers and "get to see firsthand how the ASO is a fit".

However, help seeking at an ASO occurs within a network of social relations and discourses that converge to produce a perception of being mismatched and marginalised in these agencies.

Mr Aso's economy minister, Kaoru Yosano, a fiscal conservative, and Hiroyuki Sonoda, the LDP's deputy policy chief, have been urged to form a new political party following an Aso win, teaming up with pragmatic reformists in the DPJ (who are unhappy with their own leader).

After all, the candidates have a good chance of plum posts in an Aso government even Miss Koike, who describes the LDP old guard voting for Mr Aso as "Pavlovian dogs" reacting to the stimulus of pork.The new prime minister will swiftly form his cabinet, and then deliver his policy address to the Diet on September 29th.

First, we constructed a plasmid to overexpress miR-509-5p miR-509-5p miR-509-5pO (andisynthesizedoxy-modified nucleic anid oligo) of miR-509-5p (ASO-miR-509-5p).

However, the mismatch between the identity of a heterosexual man and the social space of an ASO also has consequences when these men attempt to improve their social and political positions within these organisations.

A similar problem ensues when seeking paid positions within an ASO.

These are the kinds of insights a number of "ASO" (App Store Optimization) outfits are tracking today, in addition to App Annie, which introduced an ASO feature of its own earlier this year.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: