Sentence examples for 3 orientation from inspiring English sources

Mode 3 orientation asks for the possibilities to orient this democratic conflict by diverse and probably strongly divergent statements – a task which seems to be almost paradoxical.

Table 3 Orientation of principal stresses and stress ratio in the active cluster area.

By analysing and reflecting futures studies we can also learn something about ourselves – which would then be mode 3 orientation.

As seen from word co-occurrence networks (Fig. 3), "orientation" combined with "innovation" (or "learning") refers to the firm as the entity of analysis.

SIFT algorithm consists of four major stages: 1) scale-space extrema detection, 2) keypoint localization, 3) orientation assignment, and 4) keypoint descriptor.

To trace the possibility of such mode 3 orientation, it is necessary to reveal the reasons for and sources of divergence of futures.

Because the reads were 5'-3' oriented prior to assembly, most of the unigenes had a 5'-3' orientation.

Glass epoxy pipes with [±55°]3 orientation were fabricated using filament winding method.

The pseudoelastic responses of heat-treated CoNiAl single crystals with [0 0 1] and [1 1 5] orientations, multicrystals of nominally [1 2 3] orientation, and polycrystals are investigated under tension and compression stress states.

As expected, a 2 (group) ×3 (orientation) mixed factorial design, with alpha level set at 0.05, revealed a significant main effect of axes of orientation (F 2, 54) = 37.78, p<0.05; η2partial =  0.58).

Amplification was performed in an iCycler iQ (Biorad, Hercules, CA) Primer pairs (5'-3' orientation) used for amplification of parasite tubulin (TUB), and P-gp were: T.gTUB s CCAGGAGATGTTCAAG, T.gTUB as ACTCGGACACCAGGTCGTTC, T.gPgp s AAGGACAGCCGAAGGAAGAC, T.gPgp as GATGATGTCCGTCTGTGAC.