Sentence examples for 3 flag from inspiring English sources
I apologise for any offence caused by the 3 flag picture.
The Lipinski drug-like [14] flag and the Rule of 3 flag [40] will be associated with each molecule.
○ Cohort 3: FLAG-TET2-CD transfected cells.
As shown in Fig. 6D, myc-xMELK co-immunoprecipitated with the 3 FLAG-RACK1 constructs, but with different affinities.
One set comprises pBUN201-ZT1, pBUN301-ZT1, and pBUN401-ZT1, wharborarbor different Cas9 sequences, including hCas9-NLS-3 × FLAG in pBUN201-ZT1, 3 × FLAG-NLS-hCas9-NLS in pBUN301-ZT1 and 3 × FLAG-NLS-zCas9-NLS in pBUN401-ZT1.
For tandem purification, proteins were eluted from the beads by addition of 3× FLAG peptide (Sigma).
Simultaneously 100 µl of M2 agarose is incubated with an equal volume of 100 µg/ml 3× Flag peptide.
3× FLAG peptide was purchased from Sigma-Aldrich.
3× FLAG-tagged constructs were created by amplifying the URA3 cassette from PRS306, using a primer (BCP534) that contained the 3× FLAG epitope.
For 3× FLAG-ERα construct, a first set of oligonucleotides was used for 3× FLAG amplification: (S.1) ACCT GGATCCGCCGCCACCATGGACTACAAAGACCATGAC; (AS.1) gactggtaccgatatcagatcTATCGATGA.
