Sentence examples for 2 split from inspiring English sources

Anyhoo, I had two goals for this puzzle: 1) avoid stray O-P-S letter strings and 2) split OP/S across two words in all theme answers.

First, Handel's Concerto a Due Cori No 2 split the orchestra in two: a great opportunity to compare and contrast, surely, or at least for a bit of one-upmanship.

(2) Split the computation.

Leishmania amastigotes were seen in (Figure 2) split skin smear taken from his rash.

Thus, the statistical moments of Equations 1 and 2 split into independent moments.

Fig. 2 Split Hopkinson pressure bars and measurement apparatus (units in milimeters).

The experiment was conducted as a 3 × 2 split-plot design.

The holding company that owns the school, Apollo Group, went public at 2 1/2 (split-adjusted) in 1994.

The Nalp1b allele 2 split-GFP was generated by PCR by amplifying Nalp1b using the forward primer GATCGCTAGCGCCACCATGGAACAATCTCAG reverse primer GATCCCCGGGCACCGGTACGCGTAGA The resulting fragment was cloned into split-GFP-N1 vectors using the Nhe1 and Xma1 sites.

2. Split the avocados lengthwise and remove the pits.

But statue or not, the fourball session ended as a 2-2 split.