Sentence examples for 1st site from inspiring English sources

Exact(4)

GeneQuest (Lasergene7.1) identified two potential FoxM1-binding motifs, i.e. 5'-TATTTAT-3'and 5'-TAAATAA-3', located at −391 to −385 (1st site) and −359 to −353 bp (2nd site) upstream of the translation initiation site of PTTG1.

The oligonucleotides without biotin were used as negative control and competitors, including wild type 60 bp probe (defined as Cold Probe), −398 to −377 wild type 22 bp fragment (ATATTTC TATTTAT TTTCCATC, defined as 1st site oligo) and −367 to −363 wild type 25 bp fragment (GGGTCATC TAAATAA AAATATCTTA, defined as 2nd site oligo).

The wild type fragment (defined as Biotin-Probe and a mutant without both FoxM1 binding sites (ATATTTC gatcgtg TTTCCATCCTTTTTACAGGGTCATC atccttg AAATATCTTA AAGC, defined as Biotin-dmProbe), and −391 to −385 mutant 60 bp probe (ATATTTC gatcgtg TTTCC ATCCTTTTTACAGGGTCATC TAAATAA AAATATCTTAAAGC, defined as 1st site mProbe) were synthesized with 3'-ends labeled with biotin.

Mutation of 1st site leads to reduction of 45%% of promoter activity.

Similar(56)

The trend of phytoplankton density (number mL−1) is Site 4 > Site 5 > Site 3 > Site 1 > Site 7 > Site 6 > Site 2, while Site 4 > Site 5 > Site 7 > Site 3 > Site 2 > Site 6 > Site 1 is the trend of number of phytoplankton species assemblage.

§ 983.57 Site selection standards.

Figure 3.15: Site Manager.

It's a VH1 site.

S.L. discovered the LOM3 site.

Geology of the LOM3 site.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: